bioinformatic grna design tool (Benchling Inc)
90
Structured Review
Benchling Inc
bioinformatic grna design tool
Bioinformatic Grna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+grna+design+tool/bioinformatic+grna+design+tool/pmc10509821-53-0-6
Average 90 stars, based on 1 article reviews
Bioinformatic Grna Design Tool, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bioinformatic+grna+design+tool/bioinformatic+grna+design+tool/pmc10509821-53-0-6
Average 90 stars, based on 1 article reviews
bioinformatic grna design tool - by Bioz Stars,
2026-09
90/100 stars
Images
1) Product Images from "Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function"
Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function
Journal: Stem cell research
doi: 10.1016/j.scr.2023.103186
Figure Legend Snippet: Reagents details.
Techniques Used: Immunocytochemistry, Staining, Plasmid Preparation, Expressing, Mutagenesis, Sequencing, Binding Assay, Control
Related Articles
Immunocytochemistry:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. Staining:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. Plasmid Preparation:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. Expressing:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. Mutagenesis:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. Sequencing:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. Binding Assay:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. Control:Article Title: Generation of CHOPe003-A ESC line to study an ACTG2 variant affecting smooth muscle development and function Article Snippet: location of gRNA binding site , chr2:73914855–73914877 (nucleotide sequence: CCAGCCTTCCTTTATTGGTG AGG). .. |